Phyllidia ocellata

Distribution. Korea, Southern Japan, Thailand, Philippines, Indo-west Pacific, Indonesia, Australia, South Africa, Tanzania, Madagascar, Mauritius, Seychelles, Red Sea to Maldives, Fiji, Solomon Island, Papua New Guinea, Vanatu, Gaum to Marshall Island. DNA barcode. COI sequences of the first mentioned specimen in the “ Material examined ” are as follows: 5 ′ - CGATCATTTTTATAATGTTATTGTAACAGCTCA TGCTTTTGTAATAATTTTCTTTTTGGTAATACCT TTAATAATTGGGGGGTTCGGAAATTGAATGGTC CCATTACTAATTGGTGCTCCAGACATAAGATTT CCCCGAATAAATAATATAAGTTTTTGGTTACTA CCACCATCTTTTATTTTATTATTATGCTCAACTTT AATAGAAGGTGGAGCTGGAACAGGGTGAACTG TTTATCCCCCATTATCTGGACCAATAGGACATG GTGGGACTTCTGTTGATTTAGTAATTTTTTCTTT ACACTTAGCTGGAGCCTCTTCTCTTCTAGGGGC AATTAATTTTATTACTACTATCTTCAATATACGT TCACCTGCTATAACAATGGAACGTTTAAGATTA TTTGTTTGGTCAGTTTTAGTGACAGCTTTTCTTT TACTTCTTTCTTTACCTGTTTTAGCAGGGGCTAT TACTATACTTTTAACGGATCGAAATTTTAACA- 3 ′. According to BLAST search to GenBank, this sequence matches 88 % with Phyllidia elegans (AJ 223276). There is no COI sequence information for P. ocellata in the GenBank. Therefore more COI records from different localities of the species are needed for correct molecular identification.

Sumber: A report on species of phyllidiid and polycerid nudibranch including two species new to Korea

Distribution. Widespread in the Indo-Pacific including Mozambique (Tibirica et al. 2017), Oman, Sri Lanka, the Philippines (Debelius 1996), India (Ramakrishna et al. 2010), Myanmar (Sanpanich and Duangdee 2019), Indonesia (Yonow 1996), South Africa, Mauritius, Madagascar, Tanzania, Japan, Papua New Guinea, Australia, Guam, Fiji, Vanuatu (Gosliner et al. 2008) and known from both Andaman and Gulf waters of Thailand (Brunckhorst 1993; Chavanich et al. 2013).

Sumber: An updated inventory of sea slugs from Koh Tao, Thailand, with notes on their ecology and a dramatic biodiversity increase for Thai waters

Occurrences. Ponta do Ouro, Zavora, Nacala, Nuarro and Vamizi Island. Geographic distribution. Indo-west Pacific. Marshall Islands, Guam, Japan, Fiji, Papua New Guinea, Vanuatu, Australia (Gosliner et al. 2008), Indonesia (Yonow 1996), India (Remakrishna et al. 2010), Thailand, Philippines, Sri Lanka, Oman (Debelius 1996), Mauritius, Seychelles, Madagascar, Tanzania, South Africa (Gosliner et al. 2008) and Mozambique.

Sumber: Astonishing diversity revealed: an annotated and illustrated inventory of Nudipleura (Gastropoda: Heterobranchia) from Mozambique